Review



single stranded oligo dna sequence (83)  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher single stranded oligo dna sequence (83)

    Single Stranded Oligo Dna Sequence (83), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+83+sequencer/single+stranded+oligo+dna+sequence++83+/pmc11148569-89-7-5
    Average 90 stars, based on 1 article reviews
    single stranded oligo dna sequence (83) - by Bioz Stars, 2026-10
    90/100 stars

    Images

    1) Product Images from "Myosin inhibitor reverses hypertrophic cardiomyopathy in genotypically diverse pediatric iPSC-cardiomyocytes to mirror variant correction"

    Article Title: Myosin inhibitor reverses hypertrophic cardiomyopathy in genotypically diverse pediatric iPSC-cardiomyocytes to mirror variant correction

    Journal: Cell Reports Medicine

    doi: 10.1016/j.xcrm.2024.101520


    Figure Legend Snippet:

    Techniques Used: Recombinant, Protease Inhibitor, Western Blot, Transfection, ATPase Assay, Sequencing, Plasmid Preparation, Software

    Related Articles

    Sequencing:




    Similar Products

    90
    Thermo Fisher single stranded oligo dna sequence (83)

    Single Stranded Oligo Dna Sequence (83), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+83+sequencer/single+stranded+oligo+dna+sequence++83+/pmc11148569-89-7-5
    Average 90 stars, based on 1 article reviews
    single stranded oligo dna sequence (83) - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher nucleotide sequencing 83 metagenomic dna

    Nucleotide Sequencing 83 Metagenomic Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+83+sequencer/DNA/10__1128_slash_aem__01683___15-32-8-47
    Average 99 stars, based on 1 article reviews
    nucleotide sequencing 83 metagenomic dna - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher dna 83 sequencer

    Dna 83 Sequencer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+83+sequencer/DNA/pm25351879-28-18-21
    Average 99 stars, based on 1 article reviews
    dna 83 sequencer - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    90
    Hokkaido System Science Co dna fragment (48 from position 83 to position 36) containing a cre sequence

    Dna Fragment (48 From Position 83 To Position 36) Containing A Cre Sequence, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+83+sequencer/dna+fragment++48+from+position+83+to+position+36++containing+a+cre+sequence/10__1128_slash_aem__70__9__5244___5251__2004-121-13-20
    Average 90 stars, based on 1 article reviews
    dna fragment (48 from position 83 to position 36) containing a cre sequence - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: Cell Reports Medicine

    Article Title: Myosin inhibitor reverses hypertrophic cardiomyopathy in genotypically diverse pediatric iPSC-cardiomyocytes to mirror variant correction

    doi: 10.1016/j.xcrm.2024.101520

    Figure Lengend Snippet:

    Article Snippet: CCGTTGCAGGATCTCCTGCACTGTCA CCGGCTCCGTGGTGGTAACGGGCTC CAGGCCCTGCCATATTGTGTGCCCGC ACTCGGAAAAGCA , ThermoFisher , Single stranded oligo DNA sequence (83).

    Techniques: Recombinant, Protease Inhibitor, Western Blot, Transfection, ATPase Assay, Sequencing, Plasmid Preparation, Software